CpG11

The CpG11 phenotype was identified in a screen for ENU-induced homozygous mutants with impaired responses to Toll-like receptor (TLR) ligands (TLR Signaling Screen). Peritoneal macrophages from the index CpG11 mouse (G4562) produced normal amounts of tumor necrosis factor (TNF)-α in response to all TLR ligands tested, except oligodeoxynucleotides containing CpG motifs (CpG ODNs). CpG11heterozygotes produced intermediate levels of TNF-α relative to wild type and CpG11 homozygotes, demonstrating that the mutation is semidominant (Figure 1).

The candidate gene Tlr9 was sequenced directly, and a T to C transition was identified at position 1181, in exon 2 of 2 total exons.

1166 CTCCACCTGGCAAGTTCCTTTAAGAACCTGGTG
353  -L--H--L--A--S--S--F--K--N--L--V-

The extracellular domains of TLRs contain multiple leucine rich repeats (LRRs) that mediate ligand recognition by TLRs. TLR9 has 27 LRRs in its ectodomain. The CpG11 mutation is located in the predicted eleventh leucine rich repeat (LRR) of the TLR9 ectodomain (Figure 2).

Based on the 3D structures of TLR1, TLR2 (1), TLR3 (2-4), and other LRR-containing proteins (5), the serine mutated in CpG11 is predicted to lie in the surface-exposed α-helical second leucine-rich sequence of the affected LRR, at a position thought to permit occupancy by any amino acid, but adjacent to an invariant phenylalanine. The CpG11 phenotype indicates that a proline at this position fails to support normal function of TLR9. The mutation may disrupt ligand binding, receptor dimerization, or destroy proper folding or localization of the receptor.